Genome Chart

Examples of full genome browsers using CanvasXpress can be found in the following links for GTEX and for Gencode. Use the mouse wheel to zoom in/out or drag the vis to page across the genome.

Color Themes

   "tracks" : [{"data" : [{"dir" : "right","fill" : "rgb(51,255,255)","id" : "Reference Sequence","offset" : 1,"outline" : "rgb(0,0,0)","sequence" : "TACGTACGTACGTACGTACGTACGTACGT"},{"dir" : "right","fill" : "rgb(255,255,51)","gaps" : [
               "id" : "R1-0000-1234",
               "offset" : 1,
               "outline" : "rgb(0,0,0)",
               "sequence" : "TACGCGTAGTACGT"
               "dir" : "right",
               "fill" : "rgb(255,255,102)",
               "gaps" : [[3,1],
               "id" : "R1-0000-2345",
               "offset" : 6,
               "outline" : "rgb(0,0,0)",
               "sequence" : "ACGACGTACGACG"
               "dir" : "left",
               "fill" : "rgb(255,51,255)",
               "gaps" : [[7,2]
               "id" : "R1-0000-3456",
               "offset" : 12,
               "offsetLeft" : "23",
               "outline" : "rgb(0,0,0)",
               "sequence" : "GTACGTATAC"
               "dir" : "right",
               "fill" : "rgb(255,102,255)",
               "gaps" : [[5,1]
               "id" : "R1-0000-4567",
               "offset" : 15,
               "outline" : "rgb(0,0,0)",
               "sequence" : "CGTACTACGTA"
               "dir" : "right",
               "fill" : "rgb(51,255,255)",
               "gaps" : [[7,1]
               "id" : "R1-0000-5678",
               "offset" : 18,
               "outline" : "rgb(0,0,0)",
               "sequence" : "ACGTACGACGT"
         "subtype" : "DNA",
         "type" : "sequence"
genome <- read_json("")