Genome Chart

Examples of full genome browsers using CanvasXpress can be found in the following links for GTEX and for Gencode. Use the mouse wheel to zoom in/out or drag the vis to page across the genome.



Color Themes


{
   "tracks" : [{"data" : [{"dir" : "right","fill" : "rgb(51,255,255)","id" : "Reference Sequence","offset" : 1,"outline" : "rgb(0,0,0)","sequence" : "TACGTACGTACGTACGTACGTACGTACGT"},{"dir" : "right","fill" : "rgb(255,255,51)","gaps" : [
        [4,2],
                 [8,1]
               ],
               "id" : "R1-0000-1234",
               "offset" : 1,
               "outline" : "rgb(0,0,0)",
               "sequence" : "TACGCGTAGTACGT"
            },
            {
               "dir" : "right",
               "fill" : "rgb(255,255,102)",
               "gaps" : [[3,1],
                 [10,1]
               ],
               "id" : "R1-0000-2345",
               "offset" : 6,
               "outline" : "rgb(0,0,0)",
               "sequence" : "ACGACGTACGACG"
            },
            {
               "dir" : "left",
               "fill" : "rgb(255,51,255)",
               "gaps" : [[7,2]
               ],
               "id" : "R1-0000-3456",
               "offset" : 12,
               "offsetLeft" : "23",
               "outline" : "rgb(0,0,0)",
               "sequence" : "GTACGTATAC"
            },
            {
               "dir" : "right",
               "fill" : "rgb(255,102,255)",
               "gaps" : [[5,1]
               ],
               "id" : "R1-0000-4567",
               "offset" : 15,
               "outline" : "rgb(0,0,0)",
               "sequence" : "CGTACTACGTA"
            },
            {
               "dir" : "right",
               "fill" : "rgb(51,255,255)",
               "gaps" : [[7,1]
               ],
               "id" : "R1-0000-5678",
               "offset" : 18,
               "outline" : "rgb(0,0,0)",
               "sequence" : "ACGTACGACGT"
            }
         ],
         "subtype" : "DNA",
         "type" : "sequence"
      }
   ]
}
{
   "background" : "rgb(245,245,245)",
   "graphType" : "Genome",
   "setMax" : "30",
   "setMin" : "0"
}
library(canvasXpress)
library(jsonlite)
genome <- fromJSON("https://www.canvasxpress.org/data/cX-genomesimple.json")
canvasXpress(
  data=genome
  background="rgb(245,245,245)",
  graphType="Genome",
  setMax=30,
  setMin=0
)