The data in json format in shown below. You can edit the data and its configuration in JS Fiddle through the file menu under File → Edit in JS Fiddle. For convience you can click this .
You can also see the data and in a table format through the toolbar on the right top by clicking on the table icon or through the file menu under Explore → Table. See additional information under User Interfaces. For convience you can click this .
{ "tracks" : [{"data" : [{"counter" : 0,"dir" : "right","fill" : "rgb(51,255,255)","id" : "Reference Sequence","index" : 0,"measureText" : 108,"offset" : 1,"outline" : "rgb(0,0,0)","sequence" : "TACGTACGTACGTACGTACGTACGTACGT"},{"counter" : 1,"dir" : "right","fill" : "rgb(255,255,51)","gaps" : [ [4,2], [8,1] ], "id" : "R1-0000-1234", "index" : 1, "measureText" : 74, "offset" : 1, "outline" : "rgb(0,0,0)", "sequence" : "TACGCGTAGTACGT" }, { "counter" : 2, "dir" : "right", "fill" : "rgb(255,255,102)", "gaps" : [[3,1], [10,1] ], "id" : "R1-0000-2345", "index" : 2, "measureText" : 74, "offset" : 6, "outline" : "rgb(0,0,0)", "sequence" : "ACGACGTACGACG" }, { "counter" : 3, "dir" : "left", "fill" : "rgb(255,51,255)", "gaps" : [[7,2] ], "id" : "R1-0000-3456", "index" : 3, "measureText" : 74, "offset" : 12, "offsetLeft" : "23", "outline" : "rgb(0,0,0)", "sequence" : "GTACGTATAC" }, { "counter" : 4, "dir" : "right", "fill" : "rgb(255,102,255)", "gaps" : [[5,1] ], "id" : "R1-0000-4567", "index" : 4, "measureText" : 74, "offset" : 15, "outline" : "rgb(0,0,0)", "sequence" : "CGTACTACGTA" }, { "counter" : 5, "dir" : "right", "fill" : "rgb(51,255,255)", "gaps" : [[7,1] ], "id" : "R1-0000-5678", "index" : 5, "measureText" : 74, "offset" : 18, "outline" : "rgb(0,0,0)", "sequence" : "ACGTACGACGT" } ], "subtype" : "DNA", "type" : "sequence" } ] }
The configuration for the visualization above is shown below. You can always access the data and its configuration in any CanvasXpress visualization through the file menu under File → Reproducible Research → Show JSON code. See additional information under User Interface - Menus. For convience you can click this .
{ "backgroundGradient1Color" : "rgb(0,183,217)", "backgroundGradient2Color" : "rgb(4,112,174)", "backgroundType" : "gradient", "evenColor" : "rgb(250,250,250)", "graphType" : "Genome", "missingDataColor" : "rgb(238,238,238)", "oddColor" : "rgb(238,238,238)", "setMax" : 30, "setMin" : 0 }
Events are pre-configured in all CanvasXpress visualizations. Refer to documentation to further customize events. Most visualizations have mouseover, click, dbl-click, wheel, context-menu, drag and drop. Press the 'ESC' key to reset the plot.
All visualization come with multiple user interfaces to allow data exploration and configuration. Dbl-click to bring configurator, context-menu to open menus, mouse-over top right to visualization to show toolbar and select either the funnel to open filters and data table or the tools to open the data explorer. See further documentation under User Interfaces.
You can drag and drop any delimited text file on the visualization to create a new CanvasXpress plot. Similarly, you can drag and drop formated XML files from Wikipathways, KeGG, Metabase or GML. Furthermore, you can also drag and drop png or json files previously saved in CanvasvasXpress to re-create the visualization.
Create New Page